Dear collaborators
I have discovered this afternoon an important mistake in the Gateway Manual (V4.0). This error concerns the sequence of "attR4" (page 15) of pENTRY-R4-cis reg-L5, obtained when you recombine an "attB4R-cis regulatory region -attB5" PCR 
product with "pDONR-attP4R-attP5. Subsequently, the sequence of attB4Rfw page 16 is also wrong. I will work on it and send you as soon as possible the corrected manual directly by e-mail.
I sincerely  apologize for that mistake and hope it did not cause you too much trouble.
Best,
Agnes
Dear Eva, Dear Ferenc,
Following the mail I have sent to the whole  Gateway community, I send you the CORRECT sequence of attB4Rfw :
AttB4RFw: ggggccaagttttctatacaaagtggca
The attB5 is correct in the manual, then unchanged.
You could already check if you amplify your cis regulatory region with a wrong primer (which I guess it's the case).
I will correct the manual this week end and send you the corrected one in priority.
Again I really apologize to interfere in a bad way on your research.
Agnes
Dear Agnes,
Thank you for the info.
Yes, I used the previous primer.
Do you think that the old sequence could work in the BP reaction (because I have good entry clones from the PCR products made with this adaptor primer), but it could interfere with the LR reaction? 
Eva
Dear Eva
Sorry for the mistake.
it is very strange you obtained correct entry clones after BP reaction. Did you sequence this entry clone?
Agnes
Nincsenek megjegyzések:
Megjegyzés küldése